Sitemap

Amicuk Programming Answers

Size problem using an external database for the XML driver

-0001-11-30   Views:0

Advertisement

Hi, I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file. java.sql.SQLException: class org.xml.sax.SAXException ORA-01461: can bind a LONG value only for insert into a LONG column      

Hi,
I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file.
java.sql.SQLException: class org.xml.sax.SAXException
ORA-01461: can bind a LONG value only for insert into a LONG column
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:446)
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:456)
     at com.sunopsis.jdbc.driver.xml.v.g(v.java:631)
     at com.sunopsis.jdbc.driver.xml.v.<init>(v.java:108)
     at com.sunopsis.jdbc.driver.xml.bw.<init>(bw.java:468)
     at com.sunopsis.jdbc.driver.xml.bx.b(bx.java:292)
     at com.sunopsis.jdbc.driver.xml.bx.a(bx.java:270)
     at com.sunopsis.jdbc.driver.xml.SnpsXmlDriver.connect(SnpsXmlDriver.java:110)
     at com.sunopsis.sql.SnpsConnection.u(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.a(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.graphical.l.pm.o(pm.java)
     at com.sunopsis.graphical.l.pm.r(pm.java)
     at com.sunopsis.graphical.l.pm.g(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.iz.actionPerformed(iz.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:178)
     at java.awt.Dialog$1.run(Dialog.java:1046)
     at java.awt.Dialog$3.run(Dialog.java:1098)
     at java.security.AccessController.doPrivileged(Native Method)
     at java.awt.Dialog.show(Dialog.java:1096)
     at java.awt.Component.show(Component.java:1563)
     at java.awt.Component.setVisible(Component.java:1515)
     at java.awt.Window.setVisible(Window.java:842)
     at java.awt.Dialog.setVisible(Dialog.java:986)
     at com.sunopsis.graphical.l.pm.q(pm.java)
     at com.sunopsis.graphical.l.pm.<init>(pm.java)
     at com.sunopsis.graphical.frame.b.jh.bx(jh.java)
     at com.sunopsis.graphical.frame.bo.w(bo.java)
     at com.sunopsis.graphical.frame.bo.d(bo.java)
     at com.sunopsis.graphical.frame.w.actionPerformed(w.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161)
     at java.awt.EventDispatchThread.run(EventDispatchThread.java:122)
The error comes up when testing the XML Data Server in the Topology Manager
I pasted a segment of the XML below. Notice that the <QueryAlignmentSequence> value might be a large string, as large as 6000 bytes.
I also tried setting the varchar_length above 4000 in the external database .properties file that the XML driver reads, but the I get this error (which makes sense):
java.sql.SQLException: ORA-00910: specified length too long for its datatype
     at com.sunopsis.jdbc.driver.xml.bz.execute(bz.java:109)
     at com.sunopsis.jdbc.driver.xml.ca.execute(ca.java:30)
     at com.sunopsis.xmlfifth.h.u.a(u.java:198)
     at com.sunopsis.xmlfifth.h.bj.a(bj.java:52)
How can I import this? If I use the default "In Memory" XML connection, I get a Null pointer exception when I try to reverse it, per this other thread I posted
Unable to Reverse an XML file
I am dead in the water and getting very disappointed by this tool..
Please help
<Query><Name>IOH36464</Name><Header>IOH36464</Header><Length>5076</Length><Targets><Target><Name>NM_033380.1</Name><NcbiGeneId>1287</NcbiGeneId><GeneSymbol>COL4A5</GeneSymbol><TaxonomyId>9606</TaxonomyId><Description>Homo sapiens collagen, type IV, alpha 5 (COL4A5), transcript variant 2, mRNA</Description><Length>6445</Length><TargetAlignments><TargetAlignment><QueryStart>1</QueryStart><QueryEnd>5075</QueryEnd><TargetStart>203</TargetStart><TargetEnd>5277</TargetEnd><BitScore>10060.9</BitScore><PercentIdentity>100</PercentIdentity><Score>5075</Score><QueryAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</QueryAlignmentSequence><TargetAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</TargetAlignmentSequence>

The replay answer
Advertisement
Hi,
I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file.
java.sql.SQLException: class org.xml.sax.SAXException
ORA-01461: can bind a LONG value only for insert into a LONG column
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:446)
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:456)
     at com.sunopsis.jdbc.driver.xml.v.g(v.java:631)
     at com.sunopsis.jdbc.driver.xml.v.<init>(v.java:108)
     at com.sunopsis.jdbc.driver.xml.bw.<init>(bw.java:468)
     at com.sunopsis.jdbc.driver.xml.bx.b(bx.java:292)
     at com.sunopsis.jdbc.driver.xml.bx.a(bx.java:270)
     at com.sunopsis.jdbc.driver.xml.SnpsXmlDriver.connect(SnpsXmlDriver.java:110)
     at com.sunopsis.sql.SnpsConnection.u(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.a(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.graphical.l.pm.o(pm.java)
     at com.sunopsis.graphical.l.pm.r(pm.java)
     at com.sunopsis.graphical.l.pm.g(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.iz.actionPerformed(iz.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:178)
     at java.awt.Dialog$1.run(Dialog.java:1046)
     at java.awt.Dialog$3.run(Dialog.java:1098)
     at java.security.AccessController.doPrivileged(Native Method)
     at java.awt.Dialog.show(Dialog.java:1096)
     at java.awt.Component.show(Component.java:1563)
     at java.awt.Component.setVisible(Component.java:1515)
     at java.awt.Window.setVisible(Window.java:842)
     at java.awt.Dialog.setVisible(Dialog.java:986)
     at com.sunopsis.graphical.l.pm.q(pm.java)
     at com.sunopsis.graphical.l.pm.<init>(pm.java)
     at com.sunopsis.graphical.frame.b.jh.bx(jh.java)
     at com.sunopsis.graphical.frame.bo.w(bo.java)
     at com.sunopsis.graphical.frame.bo.d(bo.java)
     at com.sunopsis.graphical.frame.w.actionPerformed(w.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161)
     at java.awt.EventDispatchThread.run(EventDispatchThread.java:122)
The error comes up when testing the XML Data Server in the Topology Manager
I pasted a segment of the XML below. Notice that the <QueryAlignmentSequence> value might be a large string, as large as 6000 bytes.
I also tried setting the varchar_length above 4000 in the external database .properties file that the XML driver reads, but the I get this error (which makes sense):
java.sql.SQLException: ORA-00910: specified length too long for its datatype
     at com.sunopsis.jdbc.driver.xml.bz.execute(bz.java:109)
     at com.sunopsis.jdbc.driver.xml.ca.execute(ca.java:30)
     at com.sunopsis.xmlfifth.h.u.a(u.java:198)
     at com.sunopsis.xmlfifth.h.bj.a(bj.java:52)
How can I import this? If I use the default "In Memory" XML connection, I get a Null pointer exception when I try to reverse it, per this other thread I posted
Unable to Reverse an XML file
I am dead in the water and getting very disappointed by this tool..
Please help
<Query><Name>IOH36464</Name><Header>IOH36464</Header><Length>5076</Length><Targets><Target><Name>NM_033380.1</Name><NcbiGeneId>1287</NcbiGeneId><GeneSymbol>COL4A5</GeneSymbol><TaxonomyId>9606</TaxonomyId><Description>Homo sapiens collagen, type IV, alpha 5 (COL4A5), transcript variant 2, mRNA</Description><Length>6445</Length><TargetAlignments><TargetAlignment><QueryStart>1</QueryStart><QueryEnd>5075</QueryEnd><TargetStart>203</TargetStart><TargetEnd>5277</TargetEnd><BitScore>10060.9</BitScore><PercentIdentity>100</PercentIdentity><Score>5075</Score><QueryAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</QueryAlignmentSequence><TargetAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</TargetAlignmentSequence>

Go to See the other 6 answers

Size problem using an external database for the XML driver

Category:DefaultRelease time:-0001-11-30Views:130

Hi, I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file. java.sql.SQLException: class org.xml.sax.SAXException ORA-01461: can bind a LONG value only for insert into a LONG column      [More]

Problem booting from external drive

Category:DefaultRelease time:-0001-11-30Views:130

I'm having trouble booting my MacBook from an external USB drive. I've created a bootable backup of my hard drive, using SuperDuper! (in order to be able to install a bigger hard drive and restore my current drive state). If, with the drive attached,[More]

How to access tables/views of an external database provider..

Category:DefaultRelease time:2015-10-11Views:130

After much trouble I finally managed to setup a second Database Provider that doesn't display the "0 out of 0 connections are good" error by filling in the "Configuration Class" field with "intradoc.server.DbProviderConfig".[More]

Exracting data from two tables existing in external database

Category:DefaultRelease time:-0001-11-30Views:130

Hi SDN friends, I have 2 tables in external database system. I cannot create a view as I am using Netweaver Java Dictionary. I therefore would like to get the data on BI side & perform join there. TABLE1 & TABLE2 has many to many relationship. <[More]

Space problems with the SAP Database MS SQL 2000

Category:DefaultRelease time:-0001-11-30Views:130

Hi, Actually, I have a size problem with the database, I have MS SQL Server 2000 with Service Pack4 on a Windows 2003 Server environment that is my DataBase Server of my ERP ECC 6.0. On the other hand I have a storage where I have 229 Gb of free spac[More]

Updating tables in external database

Category:DefaultRelease time:-0001-11-30Views:130

Is there a way to update tables in an external database using an HTML-DB process? I want to make my "Apply Changes" button process script update an external table in database x. Example: update [email protected] set location = :P7_LOCATION,[More]

Authenticating Guest Users Using External Database.

Category:DefaultRelease time:-0001-11-30Views:130

Folks, greetings. Due to the limitations imposed by wlc's database size, we decided to go for an external authentication server. Since this external database is for guest access, we are considering in using a Linux box with LDAP, along with a web-bas[More]

BAPI to upload images to external database

Category:DefaultRelease time:-0001-11-30Views:130

Hi gurus, I need ur help despartely. I need to upload images, attachments, url, to an external database system for material master using services for object button using MM01 tcode. Using BDC we do not get this button as this is an external service.[More]

Migration from SQLserver2k, the column size are doubin the Source Database

Category:DefaultRelease time:-0001-11-30Views:130

I want to use the Oracle Migration Workbench 10.1.0.4.0 to migrate a database from SQLServer2k to Oracle 10g. In the generated Source Model I have all the nvarchar column with a size double from the SQL database size. This is not a problem for a smal[More]

Contractor information not generate in external database application.

Category:DefaultRelease time:-0001-11-30Views:130

Hi all, I'm new in IDM, and now doing some Labs. When I was doing this Lab [http://codigoctm.files.wordpress.com/2012/09/lab-04-event-handler-development.pdf], I met a problem: After a user has been created, no contractor information generated in the[More]

NOT SEE BIP FOLDER ASSIGNED BY USING BIEE EXTERNAL DATABASE TABLE AUTHENTIC

Category:DefaultRelease time:-0001-11-30Views:130

All users using BIEE external database table authentication cannot see the BI Publisher folders and data source assign to their roles. ### Steps to Reproduce ### 1) I create one table in Oracle database to store user name, password, group name and et[More]

Hot
Hi all, How can i define a internal table <b>with header line </b> in global data ??? i defined like In Types, TYPES : BEGIN OF T_XVBPLP2 ,          VENUM(10),          VEPOS(10),          POSNR(6),          VEMNG LIKE LIPS-LFIMG,          MAT [More]
Hi Experts, We have some purchase orders for all those users has not done migo postings they have done miro. now they want to clear those purchase orders is it possible? there should be corresponding posting right for clearing? is it possible to clea [More]
Hi Gurus, We are on PI 7.0 EHP 1. We have not set the parameter EO_INBOUND_PARALLEL. Does this mean there is only one inbound queue registered by default if the default value is 1? However, I seem to recall that when we had issues with messages stuck [More]
I've noticed a strange problem recently (last couple of weeks) where my mounted network shares don't always show up right away in Nautilus (side bar or desktop- like they used to). For example, if I manually mount an NFS share in CL to /media/files i [More]
We have implemented a country wide MPLS network based on 8500 platforms. We have encountered some strange connectivity problems between some PE's. Without apparent reason connectivity is lost between some PEs and restored after some time. The global [More]
Hello, we have an assignment which requires us to implement a Queue using Linked structures (nodes)... but, well, I'll just post the assignment question here. BTW, this is not a do-my-homework question. Read the whole post before you make any judgeme [More]
Hellö why can I not reinstall Photoshop CC testversion after a system restore?I am a registered subscriber to photoshop cc and lightroom . I have the requisite license key. I may have downloaded a trial version and then registered it with my registra [More]
I have and am using Adobe Premiere Elements 9. I want to use certain effects in my videos, but don't want them there throughout the whole course of the video. I just want them there at certain point's in the video. I am not sure how to do this and ca [More]
Ever since the 3.6.6 upgrade for Mac, running under OSX 10.6.4, my tabs load, but then I cannot select any of the "buried" tabs the mouse. The top tab "page load thermometer" at the bottom left of the status bar never completes to the [More]
Ok i had problems with my ipod a few weeks ago. it really ****** me off. so i bought a 5th gen ipod and sent my old one out for repair. i got it back yesterday and itunes dosent recognize it. the computer sees it as a harddrvie. what can i do?see the [More]