Sitemap

Amicuk Programming Answers

Size problem using an external database for the XML driver

-0001-11-30   Views:0

Advertisement

Hi, I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file. java.sql.SQLException: class org.xml.sax.SAXException ORA-01461: can bind a LONG value only for insert into a LONG column      

Hi,
I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file.
java.sql.SQLException: class org.xml.sax.SAXException
ORA-01461: can bind a LONG value only for insert into a LONG column
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:446)
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:456)
     at com.sunopsis.jdbc.driver.xml.v.g(v.java:631)
     at com.sunopsis.jdbc.driver.xml.v.<init>(v.java:108)
     at com.sunopsis.jdbc.driver.xml.bw.<init>(bw.java:468)
     at com.sunopsis.jdbc.driver.xml.bx.b(bx.java:292)
     at com.sunopsis.jdbc.driver.xml.bx.a(bx.java:270)
     at com.sunopsis.jdbc.driver.xml.SnpsXmlDriver.connect(SnpsXmlDriver.java:110)
     at com.sunopsis.sql.SnpsConnection.u(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.a(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.graphical.l.pm.o(pm.java)
     at com.sunopsis.graphical.l.pm.r(pm.java)
     at com.sunopsis.graphical.l.pm.g(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.iz.actionPerformed(iz.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:178)
     at java.awt.Dialog$1.run(Dialog.java:1046)
     at java.awt.Dialog$3.run(Dialog.java:1098)
     at java.security.AccessController.doPrivileged(Native Method)
     at java.awt.Dialog.show(Dialog.java:1096)
     at java.awt.Component.show(Component.java:1563)
     at java.awt.Component.setVisible(Component.java:1515)
     at java.awt.Window.setVisible(Window.java:842)
     at java.awt.Dialog.setVisible(Dialog.java:986)
     at com.sunopsis.graphical.l.pm.q(pm.java)
     at com.sunopsis.graphical.l.pm.<init>(pm.java)
     at com.sunopsis.graphical.frame.b.jh.bx(jh.java)
     at com.sunopsis.graphical.frame.bo.w(bo.java)
     at com.sunopsis.graphical.frame.bo.d(bo.java)
     at com.sunopsis.graphical.frame.w.actionPerformed(w.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161)
     at java.awt.EventDispatchThread.run(EventDispatchThread.java:122)
The error comes up when testing the XML Data Server in the Topology Manager
I pasted a segment of the XML below. Notice that the <QueryAlignmentSequence> value might be a large string, as large as 6000 bytes.
I also tried setting the varchar_length above 4000 in the external database .properties file that the XML driver reads, but the I get this error (which makes sense):
java.sql.SQLException: ORA-00910: specified length too long for its datatype
     at com.sunopsis.jdbc.driver.xml.bz.execute(bz.java:109)
     at com.sunopsis.jdbc.driver.xml.ca.execute(ca.java:30)
     at com.sunopsis.xmlfifth.h.u.a(u.java:198)
     at com.sunopsis.xmlfifth.h.bj.a(bj.java:52)
How can I import this? If I use the default "In Memory" XML connection, I get a Null pointer exception when I try to reverse it, per this other thread I posted
Unable to Reverse an XML file
I am dead in the water and getting very disappointed by this tool..
Please help
<Query><Name>IOH36464</Name><Header>IOH36464</Header><Length>5076</Length><Targets><Target><Name>NM_033380.1</Name><NcbiGeneId>1287</NcbiGeneId><GeneSymbol>COL4A5</GeneSymbol><TaxonomyId>9606</TaxonomyId><Description>Homo sapiens collagen, type IV, alpha 5 (COL4A5), transcript variant 2, mRNA</Description><Length>6445</Length><TargetAlignments><TargetAlignment><QueryStart>1</QueryStart><QueryEnd>5075</QueryEnd><TargetStart>203</TargetStart><TargetEnd>5277</TargetEnd><BitScore>10060.9</BitScore><PercentIdentity>100</PercentIdentity><Score>5075</Score><QueryAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</QueryAlignmentSequence><TargetAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</TargetAlignmentSequence>

The replay answer
Advertisement
Hi,
I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file.
java.sql.SQLException: class org.xml.sax.SAXException
ORA-01461: can bind a LONG value only for insert into a LONG column
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:446)
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:456)
     at com.sunopsis.jdbc.driver.xml.v.g(v.java:631)
     at com.sunopsis.jdbc.driver.xml.v.<init>(v.java:108)
     at com.sunopsis.jdbc.driver.xml.bw.<init>(bw.java:468)
     at com.sunopsis.jdbc.driver.xml.bx.b(bx.java:292)
     at com.sunopsis.jdbc.driver.xml.bx.a(bx.java:270)
     at com.sunopsis.jdbc.driver.xml.SnpsXmlDriver.connect(SnpsXmlDriver.java:110)
     at com.sunopsis.sql.SnpsConnection.u(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.a(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.graphical.l.pm.o(pm.java)
     at com.sunopsis.graphical.l.pm.r(pm.java)
     at com.sunopsis.graphical.l.pm.g(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.iz.actionPerformed(iz.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:178)
     at java.awt.Dialog$1.run(Dialog.java:1046)
     at java.awt.Dialog$3.run(Dialog.java:1098)
     at java.security.AccessController.doPrivileged(Native Method)
     at java.awt.Dialog.show(Dialog.java:1096)
     at java.awt.Component.show(Component.java:1563)
     at java.awt.Component.setVisible(Component.java:1515)
     at java.awt.Window.setVisible(Window.java:842)
     at java.awt.Dialog.setVisible(Dialog.java:986)
     at com.sunopsis.graphical.l.pm.q(pm.java)
     at com.sunopsis.graphical.l.pm.<init>(pm.java)
     at com.sunopsis.graphical.frame.b.jh.bx(jh.java)
     at com.sunopsis.graphical.frame.bo.w(bo.java)
     at com.sunopsis.graphical.frame.bo.d(bo.java)
     at com.sunopsis.graphical.frame.w.actionPerformed(w.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161)
     at java.awt.EventDispatchThread.run(EventDispatchThread.java:122)
The error comes up when testing the XML Data Server in the Topology Manager
I pasted a segment of the XML below. Notice that the <QueryAlignmentSequence> value might be a large string, as large as 6000 bytes.
I also tried setting the varchar_length above 4000 in the external database .properties file that the XML driver reads, but the I get this error (which makes sense):
java.sql.SQLException: ORA-00910: specified length too long for its datatype
     at com.sunopsis.jdbc.driver.xml.bz.execute(bz.java:109)
     at com.sunopsis.jdbc.driver.xml.ca.execute(ca.java:30)
     at com.sunopsis.xmlfifth.h.u.a(u.java:198)
     at com.sunopsis.xmlfifth.h.bj.a(bj.java:52)
How can I import this? If I use the default "In Memory" XML connection, I get a Null pointer exception when I try to reverse it, per this other thread I posted
Unable to Reverse an XML file
I am dead in the water and getting very disappointed by this tool..
Please help
<Query><Name>IOH36464</Name><Header>IOH36464</Header><Length>5076</Length><Targets><Target><Name>NM_033380.1</Name><NcbiGeneId>1287</NcbiGeneId><GeneSymbol>COL4A5</GeneSymbol><TaxonomyId>9606</TaxonomyId><Description>Homo sapiens collagen, type IV, alpha 5 (COL4A5), transcript variant 2, mRNA</Description><Length>6445</Length><TargetAlignments><TargetAlignment><QueryStart>1</QueryStart><QueryEnd>5075</QueryEnd><TargetStart>203</TargetStart><TargetEnd>5277</TargetEnd><BitScore>10060.9</BitScore><PercentIdentity>100</PercentIdentity><Score>5075</Score><QueryAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</QueryAlignmentSequence><TargetAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</TargetAlignmentSequence>

Go to See the other 6 answers

Size problem using an external database for the XML driver

Category:DefaultRelease time:-0001-11-30Views:130

Hi, I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file. java.sql.SQLException: class org.xml.sax.SAXException ORA-01461: can bind a LONG value only for insert into a LONG column      [More]

Problem booting from external drive

Category:DefaultRelease time:-0001-11-30Views:130

I'm having trouble booting my MacBook from an external USB drive. I've created a bootable backup of my hard drive, using SuperDuper! (in order to be able to install a bigger hard drive and restore my current drive state). If, with the drive attached,[More]

How to access tables/views of an external database provider..

Category:DefaultRelease time:2015-10-11Views:130

After much trouble I finally managed to setup a second Database Provider that doesn't display the "0 out of 0 connections are good" error by filling in the "Configuration Class" field with "intradoc.server.DbProviderConfig".[More]

Exracting data from two tables existing in external database

Category:DefaultRelease time:-0001-11-30Views:130

Hi SDN friends, I have 2 tables in external database system. I cannot create a view as I am using Netweaver Java Dictionary. I therefore would like to get the data on BI side & perform join there. TABLE1 & TABLE2 has many to many relationship. <[More]

Space problems with the SAP Database MS SQL 2000

Category:DefaultRelease time:-0001-11-30Views:130

Hi, Actually, I have a size problem with the database, I have MS SQL Server 2000 with Service Pack4 on a Windows 2003 Server environment that is my DataBase Server of my ERP ECC 6.0. On the other hand I have a storage where I have 229 Gb of free spac[More]

Updating tables in external database

Category:DefaultRelease time:-0001-11-30Views:130

Is there a way to update tables in an external database using an HTML-DB process? I want to make my "Apply Changes" button process script update an external table in database x. Example: update [email protected] set location = :P7_LOCATION,[More]

Authenticating Guest Users Using External Database.

Category:DefaultRelease time:-0001-11-30Views:130

Folks, greetings. Due to the limitations imposed by wlc's database size, we decided to go for an external authentication server. Since this external database is for guest access, we are considering in using a Linux box with LDAP, along with a web-bas[More]

BAPI to upload images to external database

Category:DefaultRelease time:-0001-11-30Views:130

Hi gurus, I need ur help despartely. I need to upload images, attachments, url, to an external database system for material master using services for object button using MM01 tcode. Using BDC we do not get this button as this is an external service.[More]

Migration from SQLserver2k, the column size are doubin the Source Database

Category:DefaultRelease time:-0001-11-30Views:130

I want to use the Oracle Migration Workbench 10.1.0.4.0 to migrate a database from SQLServer2k to Oracle 10g. In the generated Source Model I have all the nvarchar column with a size double from the SQL database size. This is not a problem for a smal[More]

Contractor information not generate in external database application.

Category:DefaultRelease time:-0001-11-30Views:130

Hi all, I'm new in IDM, and now doing some Labs. When I was doing this Lab [http://codigoctm.files.wordpress.com/2012/09/lab-04-event-handler-development.pdf], I met a problem: After a user has been created, no contractor information generated in the[More]

NOT SEE BIP FOLDER ASSIGNED BY USING BIEE EXTERNAL DATABASE TABLE AUTHENTIC

Category:DefaultRelease time:-0001-11-30Views:130

All users using BIEE external database table authentication cannot see the BI Publisher folders and data source assign to their roles. ### Steps to Reproduce ### 1) I create one table in Oracle database to store user name, password, group name and et[More]

Hot
My IMessage is sending from my email, and I am recieving Messages thru my email. I have tried to fix this by going to Settings > messaging > recieved at> and my phone number pops up along with my email. It will let me click on my email, but my ph [More]
Hi Gurus, Within our PO process, I created a PO which references a contract. Both have a Validy Period Start and End set up in customizing and filled in. But my problem is that I can still enter a Goods Receipt in MIGO to that PO, after validity has [More]
my google voice # was ported over to my droid x2 phone and i am recieving calls just fine but i am not getting any type of text messages from friends. where are they going and how do i get them to come over to me?Do you mean that your ported your Ver [More]
hey everyone i was wondering if someone could assist me and tell me how to limit a select statement to just the top 25 outputs. ie: the top 25 employees with the longest years of service. any help, i am just learning this stuff thanks joshAssuming th [More]
i want to put a password to an app is there some app than can make this happen?Sorry but no, it is not possible to put a password on any app unless the app itself was written to allow passwording. No app can be written that would set/require a passwo [More]
After installing BPC 7.5 MS SP06 processing the Planning application in ApShell throws the following error: Cannot find the object "ApShellExtra.dbo.AuditActivityHdrApShell" Looking in ApShellExtra the table doesn't exist. It seems like about 75 [More]
My phone has version 13.0.0003 on it, nokia web is telling me i can update to 21.00.00 or some thing like that but the updater software tells me my phone is up to date can any one help.SIM-locking and branding are two totally different things. If you [More]
hi, i have a question if someone can awnser that i am designing a data warehouse with dimensions and fact table. The current operational data base has four year old data. Two of the dimensions are slowly changing dimension. My question is how do you [More]
I re-upload the image because of unknown error. This is a Envy 15-3033CL volume dial part. I found that there was Top Cover part number in manual, but just this part doesn't exist individually. This question was solved. View Solution.Hi, Many parts d [More]
Hi, I have a process flow which contains two processes. Each process has 20 mappings. after the process executes correctly, I need to pick up OWB runtime ID and store it in my own audit table. How to implement this? Regards Kishan.Hello, this link is [More]