Sitemap

Amicuk Programming Answers

Size problem using an external database for the XML driver

-0001-11-30   Views:0

Advertisement

Hi, I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file. java.sql.SQLException: class org.xml.sax.SAXException ORA-01461: can bind a LONG value only for insert into a LONG column      

Hi,
I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file.
java.sql.SQLException: class org.xml.sax.SAXException
ORA-01461: can bind a LONG value only for insert into a LONG column
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:446)
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:456)
     at com.sunopsis.jdbc.driver.xml.v.g(v.java:631)
     at com.sunopsis.jdbc.driver.xml.v.<init>(v.java:108)
     at com.sunopsis.jdbc.driver.xml.bw.<init>(bw.java:468)
     at com.sunopsis.jdbc.driver.xml.bx.b(bx.java:292)
     at com.sunopsis.jdbc.driver.xml.bx.a(bx.java:270)
     at com.sunopsis.jdbc.driver.xml.SnpsXmlDriver.connect(SnpsXmlDriver.java:110)
     at com.sunopsis.sql.SnpsConnection.u(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.a(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.graphical.l.pm.o(pm.java)
     at com.sunopsis.graphical.l.pm.r(pm.java)
     at com.sunopsis.graphical.l.pm.g(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.iz.actionPerformed(iz.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:178)
     at java.awt.Dialog$1.run(Dialog.java:1046)
     at java.awt.Dialog$3.run(Dialog.java:1098)
     at java.security.AccessController.doPrivileged(Native Method)
     at java.awt.Dialog.show(Dialog.java:1096)
     at java.awt.Component.show(Component.java:1563)
     at java.awt.Component.setVisible(Component.java:1515)
     at java.awt.Window.setVisible(Window.java:842)
     at java.awt.Dialog.setVisible(Dialog.java:986)
     at com.sunopsis.graphical.l.pm.q(pm.java)
     at com.sunopsis.graphical.l.pm.<init>(pm.java)
     at com.sunopsis.graphical.frame.b.jh.bx(jh.java)
     at com.sunopsis.graphical.frame.bo.w(bo.java)
     at com.sunopsis.graphical.frame.bo.d(bo.java)
     at com.sunopsis.graphical.frame.w.actionPerformed(w.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161)
     at java.awt.EventDispatchThread.run(EventDispatchThread.java:122)
The error comes up when testing the XML Data Server in the Topology Manager
I pasted a segment of the XML below. Notice that the <QueryAlignmentSequence> value might be a large string, as large as 6000 bytes.
I also tried setting the varchar_length above 4000 in the external database .properties file that the XML driver reads, but the I get this error (which makes sense):
java.sql.SQLException: ORA-00910: specified length too long for its datatype
     at com.sunopsis.jdbc.driver.xml.bz.execute(bz.java:109)
     at com.sunopsis.jdbc.driver.xml.ca.execute(ca.java:30)
     at com.sunopsis.xmlfifth.h.u.a(u.java:198)
     at com.sunopsis.xmlfifth.h.bj.a(bj.java:52)
How can I import this? If I use the default "In Memory" XML connection, I get a Null pointer exception when I try to reverse it, per this other thread I posted
Unable to Reverse an XML file
I am dead in the water and getting very disappointed by this tool..
Please help
<Query><Name>IOH36464</Name><Header>IOH36464</Header><Length>5076</Length><Targets><Target><Name>NM_033380.1</Name><NcbiGeneId>1287</NcbiGeneId><GeneSymbol>COL4A5</GeneSymbol><TaxonomyId>9606</TaxonomyId><Description>Homo sapiens collagen, type IV, alpha 5 (COL4A5), transcript variant 2, mRNA</Description><Length>6445</Length><TargetAlignments><TargetAlignment><QueryStart>1</QueryStart><QueryEnd>5075</QueryEnd><TargetStart>203</TargetStart><TargetEnd>5277</TargetEnd><BitScore>10060.9</BitScore><PercentIdentity>100</PercentIdentity><Score>5075</Score><QueryAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</QueryAlignmentSequence><TargetAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</TargetAlignmentSequence>

The replay answer
Advertisement
Hi,
I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file.
java.sql.SQLException: class org.xml.sax.SAXException
ORA-01461: can bind a LONG value only for insert into a LONG column
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:446)
     at com.sunopsis.jdbc.driver.xml.v.a(v.java:456)
     at com.sunopsis.jdbc.driver.xml.v.g(v.java:631)
     at com.sunopsis.jdbc.driver.xml.v.<init>(v.java:108)
     at com.sunopsis.jdbc.driver.xml.bw.<init>(bw.java:468)
     at com.sunopsis.jdbc.driver.xml.bx.b(bx.java:292)
     at com.sunopsis.jdbc.driver.xml.bx.a(bx.java:270)
     at com.sunopsis.jdbc.driver.xml.SnpsXmlDriver.connect(SnpsXmlDriver.java:110)
     at com.sunopsis.sql.SnpsConnection.u(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.a(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.sql.SnpsConnection.testConnection(SnpsConnection.java)
     at com.sunopsis.graphical.l.pm.o(pm.java)
     at com.sunopsis.graphical.l.pm.r(pm.java)
     at com.sunopsis.graphical.l.pm.g(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.pm.a(pm.java)
     at com.sunopsis.graphical.l.iz.actionPerformed(iz.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:178)
     at java.awt.Dialog$1.run(Dialog.java:1046)
     at java.awt.Dialog$3.run(Dialog.java:1098)
     at java.security.AccessController.doPrivileged(Native Method)
     at java.awt.Dialog.show(Dialog.java:1096)
     at java.awt.Component.show(Component.java:1563)
     at java.awt.Component.setVisible(Component.java:1515)
     at java.awt.Window.setVisible(Window.java:842)
     at java.awt.Dialog.setVisible(Dialog.java:986)
     at com.sunopsis.graphical.l.pm.q(pm.java)
     at com.sunopsis.graphical.l.pm.<init>(pm.java)
     at com.sunopsis.graphical.frame.b.jh.bx(jh.java)
     at com.sunopsis.graphical.frame.bo.w(bo.java)
     at com.sunopsis.graphical.frame.bo.d(bo.java)
     at com.sunopsis.graphical.frame.w.actionPerformed(w.java)
     at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995)
     at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318)
     at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387)
     at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242)
     at javax.swing.plaf.basic.BasicButtonListener.mouseReleased(BasicButtonListener.java:236)
     at java.awt.Component.processMouseEvent(Component.java:6263)
     at javax.swing.JComponent.processMouseEvent(JComponent.java:3267)
     at java.awt.Component.processEvent(Component.java:6028)
     at java.awt.Container.processEvent(Container.java:2041)
     at java.awt.Component.dispatchEventImpl(Component.java:4630)
     at java.awt.Container.dispatchEventImpl(Container.java:2099)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4574)
     at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238)
     at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168)
     at java.awt.Container.dispatchEventImpl(Container.java:2085)
     at java.awt.Window.dispatchEventImpl(Window.java:2478)
     at java.awt.Component.dispatchEvent(Component.java:4460)
     at java.awt.EventQueue.dispatchEvent(EventQueue.java:599)
     at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
     at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
     at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169)
     at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161)
     at java.awt.EventDispatchThread.run(EventDispatchThread.java:122)
The error comes up when testing the XML Data Server in the Topology Manager
I pasted a segment of the XML below. Notice that the <QueryAlignmentSequence> value might be a large string, as large as 6000 bytes.
I also tried setting the varchar_length above 4000 in the external database .properties file that the XML driver reads, but the I get this error (which makes sense):
java.sql.SQLException: ORA-00910: specified length too long for its datatype
     at com.sunopsis.jdbc.driver.xml.bz.execute(bz.java:109)
     at com.sunopsis.jdbc.driver.xml.ca.execute(ca.java:30)
     at com.sunopsis.xmlfifth.h.u.a(u.java:198)
     at com.sunopsis.xmlfifth.h.bj.a(bj.java:52)
How can I import this? If I use the default "In Memory" XML connection, I get a Null pointer exception when I try to reverse it, per this other thread I posted
Unable to Reverse an XML file
I am dead in the water and getting very disappointed by this tool..
Please help
<Query><Name>IOH36464</Name><Header>IOH36464</Header><Length>5076</Length><Targets><Target><Name>NM_033380.1</Name><NcbiGeneId>1287</NcbiGeneId><GeneSymbol>COL4A5</GeneSymbol><TaxonomyId>9606</TaxonomyId><Description>Homo sapiens collagen, type IV, alpha 5 (COL4A5), transcript variant 2, mRNA</Description><Length>6445</Length><TargetAlignments><TargetAlignment><QueryStart>1</QueryStart><QueryEnd>5075</QueryEnd><TargetStart>203</TargetStart><TargetEnd>5277</TargetEnd><BitScore>10060.9</BitScore><PercentIdentity>100</PercentIdentity><Score>5075</Score><QueryAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</QueryAlignmentSequence><TargetAlignmentSequence>ATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATA</TargetAlignmentSequence>

Go to See the other 6 answers

Size problem using an external database for the XML driver

Category:DefaultRelease time:-0001-11-30Views:130

Hi, I am getting this error when trying to use an external database for the XML driver, in order to load a large XML file. java.sql.SQLException: class org.xml.sax.SAXException ORA-01461: can bind a LONG value only for insert into a LONG column      [More]

Problem booting from external drive

Category:DefaultRelease time:-0001-11-30Views:130

I'm having trouble booting my MacBook from an external USB drive. I've created a bootable backup of my hard drive, using SuperDuper! (in order to be able to install a bigger hard drive and restore my current drive state). If, with the drive attached,[More]

How to access tables/views of an external database provider..

Category:DefaultRelease time:2015-10-11Views:130

After much trouble I finally managed to setup a second Database Provider that doesn't display the "0 out of 0 connections are good" error by filling in the "Configuration Class" field with "intradoc.server.DbProviderConfig".[More]

Exracting data from two tables existing in external database

Category:DefaultRelease time:-0001-11-30Views:130

Hi SDN friends, I have 2 tables in external database system. I cannot create a view as I am using Netweaver Java Dictionary. I therefore would like to get the data on BI side & perform join there. TABLE1 & TABLE2 has many to many relationship. <[More]

Space problems with the SAP Database MS SQL 2000

Category:DefaultRelease time:-0001-11-30Views:130

Hi, Actually, I have a size problem with the database, I have MS SQL Server 2000 with Service Pack4 on a Windows 2003 Server environment that is my DataBase Server of my ERP ECC 6.0. On the other hand I have a storage where I have 229 Gb of free spac[More]

Updating tables in external database

Category:DefaultRelease time:-0001-11-30Views:130

Is there a way to update tables in an external database using an HTML-DB process? I want to make my "Apply Changes" button process script update an external table in database x. Example: update [email protected] set location = :P7_LOCATION,[More]

Authenticating Guest Users Using External Database.

Category:DefaultRelease time:-0001-11-30Views:130

Folks, greetings. Due to the limitations imposed by wlc's database size, we decided to go for an external authentication server. Since this external database is for guest access, we are considering in using a Linux box with LDAP, along with a web-bas[More]

BAPI to upload images to external database

Category:DefaultRelease time:-0001-11-30Views:130

Hi gurus, I need ur help despartely. I need to upload images, attachments, url, to an external database system for material master using services for object button using MM01 tcode. Using BDC we do not get this button as this is an external service.[More]

Migration from SQLserver2k, the column size are doubin the Source Database

Category:DefaultRelease time:-0001-11-30Views:130

I want to use the Oracle Migration Workbench 10.1.0.4.0 to migrate a database from SQLServer2k to Oracle 10g. In the generated Source Model I have all the nvarchar column with a size double from the SQL database size. This is not a problem for a smal[More]

Contractor information not generate in external database application.

Category:DefaultRelease time:-0001-11-30Views:130

Hi all, I'm new in IDM, and now doing some Labs. When I was doing this Lab [http://codigoctm.files.wordpress.com/2012/09/lab-04-event-handler-development.pdf], I met a problem: After a user has been created, no contractor information generated in the[More]

NOT SEE BIP FOLDER ASSIGNED BY USING BIEE EXTERNAL DATABASE TABLE AUTHENTIC

Category:DefaultRelease time:-0001-11-30Views:130

All users using BIEE external database table authentication cannot see the BI Publisher folders and data source assign to their roles. ### Steps to Reproduce ### 1) I create one table in Oracle database to store user name, password, group name and et[More]

Hot
In order to see pages in these languages, you can click the Region links at the top of page (where it lists a country name and says "Change"), choose your region and language from the pop-up menu. Click on "Remember this choice" under [More]
firefox is just an empty icon from what i can tell... when i upgraded to 10.9.5 on my mac firefox no longer works. it turns into a grey screen and then just ends up disappearing to the finder window... the application remains on, and won't force quit [More]
Current setup: I have a Gmail and two other accounts. All mail from two other accounts is forwarded to Gmail. I set up all three accounts on Z10. When composing a new email, I can select any of the three accounts as a sender. When replying to / forwa [More]
This may be the wrong forum, and I apologize if so.... I have a flash website for my photography business and I would like to make a link I have to "Client Photos" redirect to a specific clients files/folder with thier unique id and/or password. [More]
I am unable to install "FDM Web Application" on a 64-bit windows platform. I have an error message indicating that 64-bit components for HFM & EPMA cannot co-exist with 32-bit components for HSF/FDM. Is there a way to install it? From the pa [More]
Dear All, how can we know that particular payment is made to vendor against paricular invoice. which field will get updated Regards.Hi Appu, In FbL1N, select cleared items options and give the dates for which you want to view the report. After execut [More]
Volume levels in logic pro X keep jumping up to  5.2 and  5.0 by itself.There are no plugins nor automation activated on tracks? how can i stop the track levels from jumping? What do i do to avoid this?I and the same problem and neither of these fixe [More]
Hi, Just got a quick query about showing remaining drive space on the desktop. Before I wiped my Pismo and reinstalled Tiger (bad kernel panic), my hard drive and any other connected drives (pen drive, iPod, iDisk, etc) showed up on my Desktop with t [More]
I have a Treo800W and am trying to sync with XP Pro Outlook 2007 via USB. The phone is about a year old and I have not had problems syncing except for the last few weeks and have found some of my contacts are missing on the phone. I have tried deleti [More]
I got problems with my imessages since I installed IOS 7.0.3 ... when I seng messages to my mother, i receive de messages I sent. Can you help me ?Are you and your mother using the same Apple ID? Also check Settings > Messages > Send and Receive Fro [More]